SMARTer RACE 5'3' Kit User Manual_012615

Clontech Laboratories Inc
A Takara Bio Company
1290 Terra Bella Avenue Mountain View CA 94043 USA
US Technical Support tech@clontechcom
United
StatesCanada
8006622566
Asia Pacific
+16509197300
Europe
+33(0)139046880
Japan
+81(0)775436116
Page 1 of 30






Clontech Laboratories Inc
SMARTer® RACE 5’3’
Kit User Manual
Cat No(s) 634858 634859
(012615)
SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 2 of 30


Table of Contents
I Introduction 4
II List of Components 7
III Additional Materials Required 8
IV Primer Design 9
A Primer Sequence 9
B Additional Considerations for Design 10
C Location of Primer Sequences within Genes 10
D Nested Primers 10
V Generating RACEReady cDNA 11
A General Considerations 11
B Preparation and Handling of Total and Poly A+ RNA 11
C Assessing RNA Template Quality 12
D Protocol FirstStrand cDNA Synthesis 13
VI Rapid Amplification of cDNA Ends (RACE) 15
A Things You Should Know Before Starting RACE PCR Reactions 15
B Protocol Rapid Amplification of cDNA Ends (RACE) 15
VII Characterization of RACE Products 17
A Protocol Gel Extraction with the NuceloSpin Gel and PCR CleanUp Kit 17
B Protocol InFusion Cloning of RACE Products 18
C Sequencing RACE Products 19
VIII References 20
Appendix A Troubleshooting Guide 21
A Troubleshooting Touchdown PCR 21
B Multiple Band RACE Products 23
C Other Specific Problems 25
Appendix B Detailed Flow Chart of 5’ RACE 27
Appendix C Detailed Flow Chart of 3’ RACE 28
Appendix D 5’RACE cDNA Amplification with Random Primers 29
A Protocol FirstStrand cDNA Synthesis with Random Priming 29


SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 3 of 30


Table of Figures
Figure 1 Mechanism of SMARTer cDNA synthesis 4
Figure 2 Overview of the SMARTer RACE procedure 6
Figure 3 The relationship of genespecific primers to the cDNA template 9
Figure 4 5' and 3'RACE sample results 22
Figure 5 Detailed mechanism of the 5'RACE reactions 27
Figure 6 Detailed mechanism of the 3'RACE reactions 28
Table of Tables
Table 1 Additional 5'RACE Sequence Obtained with SMART Technology 5
Table 2 Setting up 5' and 3'RACE PCR Reactions 15
Table 3 Troubleshooting Guide Other Specific Problems 25


SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 4 of 30


I Introduction
The SMARTer RACE 5’3’ Kit provides a method for performing both 5’ and 3’rapid amplification of cDNA
ends (RACE) The SMARTer RACE 5’3’ Kit includes our SMARTer II A Oligonucleotide and SMARTScribe™
Reverse Transcriptase which provides better sensitivity less background and higher specificity than previous
kits This powerful system allows you to amplify the complete 5’ sequence of your target transcript from as little
as 10 ng of total RNA The cornerstone of SMARTer RACE cDNA synthesis is SMART® technology which
eliminates the need for problematic adaptor ligation and lets you use firststrand cDNA directly in RACE PCR a
benefit that makes RACE far less complex and much faster (Chenchik et al 1998) Additionally the SMARTer
RACE Kit exploits Clontech’s technology for suppression PCR & stepout PCR to increase the sensitivity and
reduce the background of the RACE reactions You can use either poly A+ or total RNA as starting material for
constructing fulllength cDNAs even of very rare transcripts
The SMARTer RACE 5’3’ Kit is an improved version of our original SMARTer RACE cDNA Amplification
Kit designed to accommodate larger RNA input volumes and perform more efficiently on challenging targets
(eg those that are long GCrich etc) RACE PCR products are amplified with our highly robust SeqAmp™
DNA Polymerase and cloned into the linearized pRACE vector with InFusion® HD Cloning The InFusion HD
Cloning Kit NucleoSpin Gel and PCR CleanUp Kit and Stellar™ Competent Cells are included for your
convenience in cloning RACE products
SMART technology provides a mechanism for generating fulllength cDNAs in reverse transcription reactions
(Zhu et al 2001) This is made possible by the joint action of the SMARTer II A Oligonucleotide and
SMARTScribe Reverse Transcriptase When the SMARTScribe RT reaches the 5’ end of the RNA its terminal
transferase activity adds a few additional nucleotides to the 3’ end of the firststrand cDNA (Figure 1)

Figure 1 Mechanism of SMARTer cDNA synthesis Firststrand cDNA synthesis is primed using a modified oligo (dT) primer After
SMARTScribe Reverse Transcriptase (RT) reaches the end of the mRNA template it adds several nontemplated residues The SMARTer II
A Oligonucleotide anneals to the tail of the cDNA and serves as an extended template for SMARTScribe RT

SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 5 of 30


The SMARTer II A Oligonucleotide contains a terminal stretch of modified bases that anneal to the extended
cDNA tail allowing the oligo to serve as a template for the RT SMARTScribe RT switches templates from the
mRNA molecule to the SMARTer oligo generating a complete cDNA copy of the original RNA with the
additional SMARTer sequence at the end Since the template switching activity of the RT occurs only when the
enzyme reaches the end of the RNA template the SMARTer sequence is typically only incorporated into full
length firststrand cDNAs This process guarantees that the use of high quality RNA will result in the formation
of a set of cDNAs that have a maximum amount of 5’ sequence (Table I)
Table 1 Additional 5'RACE Sequence Obtained with SMART Technology
Human gene Size of mRNA
(kb)
Additional sequence
(bp)*
Matches genomic
sequences
Piccolo presynaptic cytomatrix protein 2029 +59 yes
Dynein cytoplasmic 1 heavy chain 1 1436 +36 yes
Polycystic kidney disease 1 1414 +21 yes
Solute carrier family 1 1202 +73 yes
Microtubuleassociated protein 1A 1054 +13 yes
Spectrin beta nonerythrocytic 1024 +32 yes
Transferrin receptor 50 +25 yes
Interferonα receptor 275 +17 yes
Smooth muscle gactin 128 +31 yes
Following reverse transcription SMART technology allows firststrand cDNA to be used directly in 5’ and
3’RACE PCR reactions Incorporation of universal primer binding sites in a singlestep during firststrand cDNA
synthesis eliminates the need for tedious secondstrand synthesis and adaptor ligation This simple and highly
efficient SMARTer cDNA synthesis method ensures higher specificity in amplifying your target cDNA
Suppression PCR & stepout PCR techniques are used in combination with SMARTer technology to decrease
background amplification in RACE PCR
Requirements for SMARTer RACE cDNA Amplification
The only requirement for SMARTer RACE cDNA amplification is that you know at least 23–28 nucleotides (nt)
of sequence information in order to design genespecific primers (GSPs) for the 5’ and 3’RACE reactions
(Additional sequence information will facilitate analysis of your RACE products) This limited requirement
makes SMARTer RACE ideal for characterizing genes identified through diverse methods including cDNA
subtraction differential display RNA fingerprinting ESTs library screening and more
Uses of SMARTer RACE cDNA Amplification
SMARTer RACE cDNA amplification is a flexible tool—many researchers use this kit in place of conventional
kits to amplify just the 5’ or 3’ end of a particular cDNA Others perform both 5’ and 3’RACE and many then
go on to clone fulllength cDNAs using one of the two methods described in the latter part of this protocol In
many cases researchers obtain fulllength cDNAs without ever constructing or screening a cDNA library
SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 6 of 30



Figure 2 Overview of the SMARTer RACE procedure Detailed flow charts of the SMARTer RACE mechanisms can be found in
Appendices B & C Alternatively you can obtain the sequences of the extreme ends of the transcript by sequencing the 5’ end of the 5’
product and the 3’ end of the 3’ product Using this information you can design 5’ and 3’ genespecific primers to use in LD PCR with the
5’RACEReady cDNA as template to generate the fulllength cDNA Note that with the cloned RACE fragments you can use a restriction
site in an overlapping region to construct a fulllength cDNA by subcloning or design new GSPs to generate PCR products compatible
with InFusion cloning

SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 7 of 30


II List of Components
This section lists the components for Cat No 634858 a 10 reaction kit The larger 20 reaction kit (Cat No
634859) contains two of every item listed below
SMARTer RACE 5’3’ Kit Components (Cat No 634860) (Not sold separately)
Store SMARTer II A Oligonucleotide and Control Mouse Heart Total RNA at –70°C Store all other components
at –20°C
 FirstStrand cDNA Synthesis
o 10 µl SMARTer II A Oligonucleotide (24 μM)
o 10 µl 3' RACE CDS Primer A (12 μM)
o 10 µl 5' RACE CDS Primer A (12 μM)
o 10 µl 10X Random Primer Mix (20 μM)
o 40 µl 5X FirstStrand Buffer (RNAseFree)
o 5 µl Dithiothreitol (DTT) (100 mM)
o 1 ml Deionized H2O
o 10 µl RNase Inhibitor (40 Uµl)
o 20 µl SMARTScribe Reverse Transcriptase (100 Uµl)
o 10 µl dNTP mix (20 mM)
 5’ and 3’RACE PCR
o 400 µl 10X Universal Primer A Mix (UPM)
o 50 µl Universal Primer Short (10 µM)
o 5 µl Control Mouse Heart Total RNA (1 µgµl)
o 25 µl Control 5'RACE TFR Primer (10 µM designed for compatibility with InFusion cloning)
o 25 µl Control 3'RACE TFR Primer (10 µM designed for compatibility with InFusion cloning)
 InFusion Cloning
o 10 µl Linearized pRACE (50 ngµl)
 General Reagents
o 2 tubes TricineEDTA Buffer (1 ml each)
SeqAmp DNA Polymerase (Cat No 638504)
Store all components at –20°C
 50 μl SeqAmp DNA Polymerase
 125 ml SeqAmp PCR Buffer (2X)
InFusion HD Cloning Kit (Cat No 639648) (Not sold separately)
Store all components at –20°C
 20 μl 5X InFusion HD Enzyme Premix
 5 μl pUC19 Control Vector linearized (50 ngμl)
 10 μl 2 kb Control Insert (40 ngμl)

NucleoSpin Gel and PCR CleanUp Kit (Cat No 74060910) (Not sold separately)
Store all components at room temperature
 10 ml Binding Buffer NTI
 6 ml Wash Buffer NT3 (concentrate)
 5 ml Elution Buffer NE (5 mM TrisHCl pH 85)
 10 NucleoSpin Gel and PCR CleanUp Columns (yellow rings)
 10 Collection Tubes (2 ml)
SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 8 of 30


Stellar Competent Cells (Cat No 636763)
Store Stellar Competent Cells at –70°C Store all other components at –20°C
 10 tubes Stellar Competent Cells (100 µltube)
 10 tubes SOC Medium (1 mltube)
 10 µl pUC19 Vector (01 ngµl)
III Additional Materials Required
If your RNA template is from a noneukaryotic organism and lacks a polyadenylated tail you can add one
prior to firststrand 3’cDNA synthesis using the following enzyme
 Poly(A) Polymerase (Takara Bio Cat No 2180A)
The following materials are required for InFusion cloning and transformation but not supplied
 Ampicillin (100 mgml stock) or other antibiotic required for plating the InFusion reaction
 LB (LuriaBertani) medium (pH 70)
 LBantibiotic plates
The following material is required for the NucleoSpin Gel and PCR CleanUp Kit but not supplied
 96–100 ethanol

SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 9 of 30


IV Primer Design
A Primer Sequence
GeneSpecific Primers (GSPs) should
 be 23–28 nt to ensure specific annealing
 be 50–70 GC
 have a Tm ≥65°C best results are obtained if Tm >70°C which enables the use of touchdown PCR
(Tm should be calculated based upon the 3’ (genespecific) end of the primer NOT the entire primer)
 not be complementary to the 3’end of the Universal Primer Mix
Long primer 5’–CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT–3'
Short primer 5’–CTAATACGACTCACTATAGGGC–3’
 be specific to your gene of interest
 both have 15 bp overlaps with the vector at their 5’ ends (ie add the sequence
GATTACGCCAAGCTT to the 5’ ends of both GSPs’ sequences see details below)
The relationship of the primers used in the SMARTer RACE reactions to the template and resulting
RACE products are shown in detail in Figure 3
For the complete SMARTer RACE protocol you will need at least two GSPs an antisense primer for the
5’RACE PCR and a sense primer for the 3’RACE PCR If you are performing only 5’ or 3’RACE
you will only need one GSP In our experience longer GSPs with annealing temperatures above 70°C
give more robust amplification in RACE particularly from difficult samples however there is generally
no advantage to using primers with genespecific sequence longer than 30 nt
Successful InFusion cloning requires a 15 bp overlap with the linearized vector Given this you will need
to add the sequence GATTACGCCAAGCTT to the 5’end of your 5’ and 3’ GSPs to facilitate InFusion
cloning of your RACE PCR products This specific sequence is in addition to the 22 nt genespecific
sequence described above The provided linearized pRACE vector already contains this overlap with the
Universal Primer A Mix included for PCR and adding this sequence to the 5’end of your GSPs will
complete the necessary overlap for the cloning reaction Please note that the InFusion User Manual
contains only general primer recommendations that should not be used for this particular protocol

Figure 3 The relationship of genespecific primers to the cDNA template This diagram shows a generalized firststrand
cDNA template This RNADNA hybrid does not precisely represent either the 5’ or 3’RACEReady cDNAs For a detailed
look at those structures see Appendices B & C Note that the genespecific primers designed here contain tails with InFusion
homology and also produce overlapping RACE products This overlap permits the use of the primers together in a control PCR
reaction Additionally if a suitable restriction site is located within this region it will be possible to construct the fulllength
cDNA by subcloning
SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 10 of 30


B Additional Considerations for Design
The primers shown in Figure 3 will create overlapping 5’ and 3’RACE products If a suitable restriction
site is located in the region of overlap the fragments can subsequently be joined by restriction digestion
and ligation to create the fulllength cDNA If no suitable restriction sites are available you can
alternately design new GSPs suitable for multifragment InFusion cloning By designing primers that
give a 100–200bp overlap in the RACE products you will also be able to use the primers together as an
internal positive control for the PCR reactions However it is not absolutely necessary to use primers that
give overlapping fragments In the case of large andor rare cDNAs it may be better to use primers that
are closer to the ends of the cDNA and therefore do not create overlapping fragments The primers
themselves can overlap (ie be complementary)
C Location of Primer Sequences within Genes
We have had good success using the SMARTer RACE Kit to amplify 5’ and 3’ cDNA fragments that
extend up to 65 kb from the GSP binding sites Nevertheless for optimum results we recommend
choosing your primers so that the 5’ and 3’RACE products will range from 1–3 kb in length If you are
working with an annotated genome we suggest using NCBI’s PrimerBLAST to aid in your design for
each transcript
D Nested Primers
We recommend that you do not use nested PCR in your initial experiments The UPM Primer and a GSP
will usually generate a good RACE product with a low level of nonspecific background However nested
PCR may be necessary in some cases where the level of background or nonspecific amplification in the
5’ or 3’RACE reaction is too high with a single GSP In nested PCR a primary amplification is
performed with the outer primers and if a smear is produced an aliquot of the primary PCR product is re
amplified using the inner primers The SMARTer RACE protocols include optional steps indicating
where nested primers can be used The Universal Primer Short (provided with the kit) can be used for
both 5’ and 3’RACE with nested primers
Nested gene specific primers (NGSP) should be designed according to the same guidelines discussed
above If possible nested primers should not overlap with the outer genespecific primers if they must
overlap due to limited sequence information the 3’ end of the inner primer should have as much unique
sequence as possible Additionally your nested primers should also contain the 15 bp overlap required for
InFusion cloning

SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 11 of 30


V Generating RACEReady cDNA
PLEASE READ THE ENTIRE PROTOCOL BEFORE STARTING
A General Considerations
 We recommend using the TricineEDTA Buffer provided in the kit to resuspend and dilute your
cDNA samples throughout the protocols in this user manual because Tricine buffers maintain their
pH at high temperature better than Trisbased buffers Trisbased buffers can lead to low pH
conditions that degrade DNA
 Resuspend pellets and mix reactions by gently pipetting the solution up and down or by flicking the
bottom of the tube Always spin tubes briefly prior to opening to collect the contents at the bottom of
the tubes
 Perform all reactions on ice unless otherwise indicated
 Add enzymes to reaction mixtures last
 Ethidium bromide (EtBr) is a carcinogen Use appropriate precautions when handling and disposing
of this reagent For more information see Molecular Cloning A Laboratory Manual by Sambrook &
Russell (2001)
B Preparation and Handling of Total and Poly A+ RNA
1 General Precautions
The integrity and purity of your total or poly A+ RNA starting material is an important element in
highquality cDNA synthesis The following precautions will help you avoid contamination and
degradation of your RNA
 Have a separate bench andor pipette set dedicated to RNA work free of RNase
contamination
 Wear gloves throughout to protect your RNA samples from nucleases
 Use freshly deionized (eg MilliQgrade) H2O directly without treatment with DEPC
(diethyl pyrocarbonate) Takara Bio also offers RNaseFree Water (Cat No 9012)
 Use only singleuse plastic pipettes and pipette tips Filter tips are recommended
2 RNA Isolation
Clontech® offers several kits for isolating total or poly A+ RNA from a variety of sources
Purified Product Starting Material Product Cat #
Total RNA Cells tissues or cellfree
biological fluids NucleoSpin RNA II 74095550
Total RNA Plant or fungal samples NucleoSpin RNA Plant 74094950
mRNA Total RNA cells or tissues NucleoTrap mRNA Mini 740655
mRNA Total RNA derived from
cultured cells or animal tissues
Magnosphere UltraPure
mRNA Purification Kit 9186
Many procedures are available for the isolation of poly A+ RNA (Farrell 1993 Sambrook et al
2001)
SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 12 of 30


3 RNA Purity
The purity of RNA is the key factor for successful cDNA synthesis and SMARTer RACE The
presence of residual organics metal ions salt or nucleases in your RNA sample can have a large
impact on downstream enzymatic applications by inhibiting enzymatic activity or degrading the
RNA We strongly recommend checking the stability of your RNA to ensure that it is free of
contaminants Impurities such as salt or organic contaminants can be removed by repeated
ethanol precipitation subsequent washing with 80 ethanol and the complete removal of all
remaining ethanol
Since RNA stability is a good indicator of RNA purity we strongly recommend checking the
stability of your RNA to ensure that it is free of contaminants
Incubate a small portion of your RNA at 37°C for 2 hours then compare the sample to a duplicate
control stored at –70°C If the sample incubated at 37°C shows a lower 28S18S ratio than the
control or a significant downward shift on a formaldehyde agarose gel the RNA may have
nuclease contaminants (see Section VC below for methods for assessing RNA quality)
If your RNA template is from a plant or some other species with high pigment levels please
pay special attention to polysaccharidepigment contamination Polysaccharidespigments are
hard to remove and can’t be detected on the agarose gel These glycoproteins might interfere with
primer binding sites of RNA during the firststrand cDNA synthesis leading to reduced cDNA
yield
C Assessing RNA Template Quality
1 Methods for Assessing Total RNA Integrity
 Detection with the Agilent 2100 BioAnalyzer (Agilent Technologies CA)
This microfluidicsbased technology which provides an alternative to traditional gel
based analysis requires only 2–7 ng of RNA per analysis We recommend using RNA
samples with an RNA Integrity Number (RIN) of 7 or higher In addition to assessing
RNA quality this automated system provides a good estimate of RNA concentration
 If you do not have access to an Agilent 2100 BioAnalyzer you can visualize your RNA
on a denaturing formaldehyde agarose gel under UV light The theoretical 28S18S ratio
for eukaryotic RNA is approximately 21 If the 28S18S ratio of your RNA is less than 1
your RNA template is not suitable for SMARTer RACE When visualizing RNA using
EtBr you need at least 05–1 µg of total RNA Alternatively SYBR® Green II or SYBR
Gold dyes (Molecular Probes Eugene OR) allow you to detect as little as 1 or 2 ng of
RNA on your gel respectively
2 Methods for Assessing mRNA Integrity
All of the methods mentioned above can be used to assess the quality of your mRNA However
because mRNA does not contain strong ribosomal bands the assessment of its quality will be
somewhat subjective Typically mRNA appears as a smear between 05 kb to 6 kb with an area
of higher intensity around 15 and 2 kb This size distribution may be tissue or speciesspecific If
the average size of your mRNA is less than 15 kb it could be an indication of degradation
SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 13 of 30


D Protocol FirstStrand cDNA Synthesis
The two 20 µl reactions described in the protocol convert 10 ng–1 µg of total or poly A+ RNA into
RACEReady firststrand cDNA
We recommend that you use poly A+ RNA whenever possible However if you have less than 50 µg of
total RNA we do not recommend purification of poly A+ RNA because the final yield will be too small to
effectively analyze the RNA quantity and quality
We strongly recommend that you perform a positive control cDNA synthesis using the included
Mouse Heart Total RNA in addition to your experimental reactions
NOTE If your RNA template is from a noneukaryotic organism andor lacks a polyadenylated tail
follow the protocol for 5’firststrand cDNA synthesis with random primers in Appendix D
For 3’firststrand cDNA synthesis add a poly(A) tail using Poly(A) Polymerase (Takara Cat No
2180A) and proceed with the following protocol

IMPORTANT
 Prior to cDNA synthesis please make sure that your RNA is intact and free of contaminants (see
Section VC Assessing the Quality of the RNA Template)
 Do not change the volume of any of the reactions All components have been optimized for the
volumes specified
1 Prepare enough of the following Buffer Mix for all of the 5’ and 3’RACEReady cDNA synthesis
reactions plus 1 extra reaction to ensure sufficient volume Mix the following reagents and spin
briefly in a microcentrifuge then set aside at room temperature until Step 6
40 µl 5X FirstStrand Buffer
05 µl DTT (100 mM)
10 µl dNTPs (20 mM)
55 µl Total Volume
2 Combine the following reagents in separate microcentrifuge tubes
For preparation of
5’RACEReady cDNA For preparation of
3’RACEReady cDNA
10–10 µl RNA* 10–11 µl RNA*
10 µl 5’CDS Primer A 10 µl 3’CDS Primer A
0–9 µl Sterile H2O 0–10 µl Sterile H2O
11 µl Total Volume 12 µl Total Volume
*For the control reactions use 1 µl of Control Mouse Heart Total RNA (1 µgµl)
3 Mix contents and spin the tubes briefly in a microcentrifuge

SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 14 of 30


4 Incubate tubes at 72°C for 3 minutes then cool the tubes to 42°C for 2 minutes After cooling spin
the tubes briefly for 10 seconds at 14000 x g to collect the contents at the bottom
NOTE This step can be performed in a thermal cycler While the tubes are incubating you can
prepare the Master Mix in Step 6
5 To just the 5’RACE cDNA synthesis reaction(s) add 1 µl of the SMARTer II A Oligonucleotide
per reaction
6 Prepare enough of the following Master Mix for all 5’ and 3’RACEReady cDNA synthesis
reactions Mix these reagents at room temperatures in the following order
55 µl Buffer Mix from Step 1
05 µl RNase Inhibitor (40 Uµl)
20 µl SMARTScribe Reverse Transcriptase (100 U)
80 µl Total Volume
7 Add 8 µl of the Master Mix from Step 6 to the denatured RNA from Step 4 (3’RACE cDNA) and
Step 5 (5’RACE cDNA) for a total volume of 20 µl per cDNA synthesis reaction
8 Mix the contents of the tubes by gently pipetting and spin the tubes briefly to collect the contents at
the bottom
9 Incubate the tubes at 42°C for 90 minutes in an air incubator or a hotlid thermal cycler
NOTE Using a water bath for this incubation may reduce the volume of the reaction mixture (due to
evaporation) and therefore reduce the efficiency of firststrand cDNA synthesis
10 Heat tubes at 70°C for 10 minutes
11 Dilute the firststrand cDNA synthesis reaction product with TricineEDTA Buffer
 Add 10 µl if you started with <200 ng of total RNA*
 Add 90 µl if you started with >200 ng of total RNA*
 Add 240 µl if you started with poly A+ RNA
*The copy number of your gene of interest should be the determining factor for diluting your sample
If you have 200 ng of total RNA but your gene of interest has low abundance dilute with 10 µl If
you have 200 ng of total RNA and the gene of interest is highly abundant dilute with 90 µl
12 You now have 3’ and 5’RACEReady cDNA samples Samples can be stored at –20°C for up to
three months

SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 15 of 30


VI Rapid Amplification of cDNA Ends (RACE)
PLEASE READ THE ENTIRE PROTOCOL BEFORE STARTING
At this point you have 3’ and 5’RACEReady cDNA samples The RACE reactions in this section use only a
fraction of this material for each RNA of interest There is sufficient singlestranded cDNA for PCR amplification
of multiple genes
A Things You Should Know Before Starting RACE PCR Reactions
If you intend to use LD PCR to construct your fulllength cDNA after completing 5’ and 3’RACE be
sure to set aside an aliquot of the 5’RACEReady cDNA to use as a template in the PCR reaction
Please note that the efficiency of RACE PCR depends on the abundance of the mRNA of interest in your
RNA sample Additionally different primers will have different optimal annealingextension
temperatures Refer to the Troubleshooting Guide (Appendix A) for suggestions on optimizing PCR
conditions
NOTE This is a RACEspecific protocol It differs from the general SeqAmp protocol in many regards
B Protocol Rapid Amplification of cDNA Ends (RACE)
This procedure describes the 5’RACE and 3’RACE PCR reactions that generate the 5’ and 3’ cDNA
fragments We recommend that you also perform positive control 5’ and 3’RACE using the TFR
primers and UPM Although the Universal Primer Short (UPM short) is provided nested PCR is
generally not necessary in SMARTer RACE reactions
1 Prepare enough PCR Master Mix for all of the PCR reactions plus one extra reaction to ensure
sufficient volume The same Master Mix can be used for both 5’ and 3’RACE reactions For each
50 µl PCR reaction mix the following reagents
155 µl PCRGrade H2O
250 µl 2X SeqAmp Buffer
10 µl SeqAmp DNA Polymerase
415 µl Total Volume

2 Prepare PCR reactions as shown below in Table 2 Add the components to 05 ml PCR tubes in the
order shown and mix gently
Table 2 Setting up 5' and 3'RACE PCR Reactions
Component 5’ or 3’RACE
Sample
UPM only
(– control)
GSP only
(– control)
5’ or 3’RACEReady cDNA
(experimental) 25 µl 25 µl 25 µl
10X UPM 5 µl 5 µl —
5’ or 3’ GSP (10 µM) 1 µl — 1 µl
H2O — 1 µl 5 µl
Master Mix (Step 1) 415 µl 415 µl 415 µl
Total Volume 50 µl 50 µl 50 µl

SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 16 of 30


3 Commence thermal cycling using one of the following PCR programs (both programs 1 and 2 work
with the positive control 5’ and 3’RACE TFR and UPM Primers) Be sure to choose the correct
number of cycles (as noted) based on whether you started with poly A+ or total RNA
NOTES ON CYCLING You may need to determine the optimal cycling parameters for your gene
empirically because the number of cycles necessary depends on the abundance of the target
transcript Run 20 or 25 PCR cycles first as described and analyze 5 µl from each tube along with
appropriate DNA size markers on a 12 agaroseEtBr gel If you see weak bands or no bands return
the tube(s) to your thermal cycler and perform five additional cycles (according to the third set of
cycles for touchdown PCR) The optimal extension time depends on the length of the desired
amplicon For 02–2 kb amplicons we typically extend for 2 minutes for 2–4 kb amplicons we
extend for 3 minutes and for 5–10 kb amplicons we extend for up to 10 minutes

NOTE The Tm should be calculated based upon the 3’ (genespecific) end of the primer and NOT
the entire primer
Program 1 (touchdown PCR—preferred use if GSP Tm >70°C)
 5 cycles
94°C 30 sec
72°C 3 min*
 5 cycles
94°C 30 sec
70°C 30 sec
72°C 3 min*
 20 cycles (Poly A+ RNA) OR 25 cycles (Total RNA)
94°C 30 sec
68°C 30 sec
72°C 3 min*
*If fragments >3 kb are expected add 1 minute for each additional 1 kb
Program 2 (use if GSP Tm 60–70°C)
 20 cycles (Poly A+ RNA) OR 25 cycles (Total RNA)
94°C 30 sec
68°C 30 sec
72°C 3 min*
*If fragments >3 kb are expected add 1 minute for each additional 1 kb

SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 17 of 30


4 [OPTIONAL] If the primary PCR reaction fails to give the distinct band(s) of interest or produces a
smear you may wish to perform a secondary or nested PCR reaction using the Universal Primer
Short (UPM short supplied) and a NGSP (See the discussion in Section IVD) This result is more
common for transcripts that are less abundant The suggested secondary PCR will most likely result
in the expected distinct band(s)
a Dilute 5 µl of the primary PCR product into 245 µl of TricineEDTA buffer
b Repeat Steps 1–3 above using
i 5 µl of the diluted primary PCR product in place of the RACEReady cDNAs
ii 1 µl of the Universal Primer Short and 1 µl of your nested GSPs
iii 15–20 cycles of Program 2
NOTE The Troubleshooting Guide (Appendix A) discusses several control reactions that will
help you troubleshoot your RACE reactions if yields are suboptimal
VII Characterization of RACE Products
At this point we recommend that you characterize your RACE fragments and confirm that you have amplified the
desired product This procedure can prevent confusion and wasted effort when you generate the fulllength
cDNA even if you have single major products from both the 5’ and 3’RACE reactions Characterization is
especially important if you have multiple bands or if you suspect that you are working with a member of a
multigene family Multiple bands are more common with 5’RACE than with 3’RACE Multiple transcriptional
start sites tend to create a number of different transcripts and there’s a good chance these multiple bands are real
variants and not artifacts
We provide you with the materials necessary for the suggested method of characterizing RACE products via
cloning and sequencing (Sections B & C below)
A Protocol Gel Extraction with the NuceloSpin Gel and PCR CleanUp Kit
For more details on the included NucleoSpin Gel and PCR CleanUp Kit please download its User
Manual from our website at wwwclontechcommanuals
Before you start Add 24 ml of 96–100 ethanol to Wash Buffer NT3 Mark the label of the bottle to
indicate that ethanol was added Wash Buffer NT3 is stable at room temperature (18–25°C) for at least
one year
1 Electrophorese your RACE DNA sample on an agaroseEtBr gel We recommend using a buffer
system containing either TAE (40 mM Trisacetate [pH 8] 1 mM EDTA) or TBE (45 mM Trisborate
[pH 8] 1 mM EDTA)
2 Locate the position of your fragment under UV light Use a clean scalpel or razor blade to excise the
DNA fragment of interest Cut close to the fragment to minimize the surrounding agarose Estimate
the amount of DNA present in the gel slice
NOTE Minimize UV exposure time to avoid damaging the DNA
3 Measure the weight of the gel slice and transfer it to a clean 15 ml microcentrifuge tube
4 For each 100 mg of agarose add 200 µl Buffer NTI
5 Incubate the sample for 5–10 minutes at 50°C Vortex every 2–3 minutes until the gel slice is
completely dissolved
SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 18 of 30


6 Place a NucleoSpin Gel and PCR CleanUp Column into a Collection Tube (2 ml) and load up to
700 µl of sample Centrifuge for 30 seconds at 11000 x g Discard flowthrough and place the
column back into the collection tube Load remaining sample if necessary and repeat the
centrifugation step
7 Add 700 µl Buffer NT3 to the column Centrifuge for 30 seconds at 11000 x g Discard flowthrough
and place the column back into the collection tube
8 Centrifuge for 1 minute at 11000 x g to remove Buffer NT3 completely Make sure the spin column
does not come in contact with the flowthrough while removing it from the centrifuge and collection
tube
NOTE Residual ethanol from Buffer NT3 might inhibit enzymatic reactions Total removal of
ethanol can be achieved by incubating the columns for 2–5 minutes at 70°C prior to elution (Step 9)
9 Place the column into a new 15 ml microcentrifuge tube (not provided) Add 15–30 µl Buffer NE
and incubate at room temperature (18–25°C) for 1 minute Centrifuge for 1 minute at 11000 x g to
elute DNA
NOTE DNA recovery of larger fragments (>1000 bp) can be increased by multiple elution steps
with fresh buffer heating to 70°C and incubation for 5 minutes
B Protocol InFusion Cloning of RACE Products
For more details on the included InFusion HD Cloning Kit please download its User Manual from our
website at wwwclontechcommanuals
1 Combine
1 µl Lineareized pRACE vector (provided with SMARTer RACE 5’3’ Kit Components)
7 µl Gelpurified RACE product (Section VIIA Step 9)
2 µl InFusion HD Master Mix
10 µl Total Volume
2 Incubate for 15 minutes at 50°C and transfer to ice
3 Follow the protocol provided with your Stellar Competent Cells to transform the cells with 25 µl of
the InFusion reaction mixture
IMPORTANT DO NOT add more than 5 µl of the reaction to 50 µl of competent cells More is not
better Using too much of the reaction mixture inhibits the transformation
4 Place 1100–15 of each transformation reaction into separate tubes and bring the volume to 100 µl
with SOC medium Spread each diluted transformation on a separate LB plate containing 100 µgml
of ampicillin
5 Centrifuge the remainder of each transformation at 6000 rpm for 5 minutes Discard the supernatant
and resuspend each pellet in 100 µl fresh SOC medium Spread each sample on a separate LB plate
containing the appropriate antibiotic Incubate all of the plates overnight at 37°C
6 The next day pick individual isolated colonies from each experimental plate Isolate plasmid DNA
using a standard method of your choice (eg miniprep) To determine the presence of your RACE
SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 19 of 30


insert analyze the DNA by PCR screening (with your GSPs) or restriction digest (with EcoRI and
HindIII which flank the cloning site)
NOTE For 5’RACE products we recommend picking at least 8–10 different independent clones in
order to obtain the maximum amount of sequence at the 5’end (see the note on fulllength cDNA in
Section C below)
C Sequencing RACE Products
Once you have identified the clones containing the largest genespecific inserts obtain as much sequence
data as you can Ideally you will be able to sequence the entire open reading frame as well as the 5’ and
3’ untranslated regions
NOTE The provided pRACE vector is a pUC19based vector and is compatible with M13 sequencing
primers for characterization of your cloned insert(s) Because InFusion cloning is directional you can
preferentially use the M13F primer to sequence into the UPM end and the M13R primer to sequence into
the genespecific end

The UPM contains a T7 priming site which can be used for Sanger sequencing but we recommend using
M13 primers to get full clean reads of your experimental sequence The T7 priming sites are too close to
the 5’ and 3’cloning sites to ensure complete coverage in the sequencing trace
A note on fulllength cDNA
No method of cDNA synthesis can guarantee a fulllength cDNA particularly at the 5’ end Determining
the true 5’ end requires some combination of RNase protection assays primer extension assays and
cDNA or genomic sequence information Many SMARTer RACE cDNAs include the complete 5’ end of
the cDNA however severe secondary structure may block the action of RT andor SeqAmp DNA
Polymerase in some instances In our experience SMARTer RACE products and fulllength cDNAs
compare favorably in this regard with cDNAs obtained by conventional RACE or from libraries
Options for generating fulllength cDNA
After the RACE products have been characterized by partial or complete sequencing you can generate
the fulllength cDNA by one of two methods
 By long distance PCR (LD PCR) using primers designed from the extreme 5’ and 3’ ends of your
cDNA and the 5’RACEReady cDNA as a template
 By cloning overlapping 5’ and 3’RACE fragments using a restriction site in the overlapping region
(if available) If no suitable restriction sites are available you can alternately design new GSPs
suitable for multifragment InFusion cloning
NOTE Details on multifragment InFusion cloning can be found in our tech note InFusion Multiple
Fragment Cloning

SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 20 of 30


In general the LD PCR method is more direct and less subject to complications or artifacts With cloning
it is possible to join 5’ and 3’ cDNA fragments derived from two different transcripts this could occur
with two different forms of a polymorphic RNA or with transcripts from a multigene family In contrast
with endtoend PCR the 5’ and 3’ end primers will amplify a single cDNA without the possibility of
generating a hybrid Virtually all cDNAs are within the range of LD PCR
If you are going to use your cloned RACE products for further analysis we recommend that you generate
your fulllength cDNA using SeqAmp DNA Polymerase and InFusion HD Cloning
If you do not wish to characterize your RACE products via cloning and sequencing you may choose from
the following alternative methods
 Comparison of RACE Products Obtained with GSPs & NGSPs
For the 5’ and 3’RACE reactions compare the products of primary amplifications performed
with the UPM Mix and GSP to the secondary products obtained using the UPM and NGSP If
multiple bands are observed bands representing real transcripts should be slightly smaller in the
reaction using NGSPs The difference in size should correspond to the positions of the outer and
inner (nested) GSPs in the cDNA structure Multiple bands that are the result of nonspecifically
primed PCR should disappear upon amplification with UPM and NGSPs
 Southern Blot Analysis
You can obtain stronger confirmation of your RACE products by probing a Southern blot with an
internal genespecific probe (usually one of your other GSPs or NGSPs) This method can be
particularly useful for determining which bands are real when RACE produces multiple bands
Larger RACE products that do not hybridize to genespecific probes are generally due to
nonspecific priming Smaller bands that do hybridize to your probe may be the result of
incomplete reverse transcription however you cannot exclude the possibility that some of these
shorter bands are real and correspond to alternativelyspliced transcripts transcripts derived from
multiple promoters or other members of a multigene family
VIII References
1 Chenchik A Zhu Y Diatchenko L Li R Hill J & Siebert P (1998) Generation and use of highquality
cDNA from small amounts of total RNA by SMART PCR In Gene Cloning and Analysis by RTPCR Eds
Siebert P & Larrick J (BioTechniques Books MA) pp 305–319
2 Zhu YY Machleder E M Chenchik A Li R & Siebert P M (2001) Reverse transcriptase template
switching A SMART™ approach for fulllength cDNA library construction BioTechniques 30892–897
3 Sambrook J & Russell D W (2001) Molecular Cloning A Laboratory Manual Third Edition (Cold Spring
Harbor Laboratory Cold Spring Harbor NY)
4 Farrell Jr R E (1993) RNA Methodologies A Lab Guide for Isolation and Characterization (Academic
Press San Diego CA)
5 Don R H Cox PT Wainwright B J Baker K & Mattick J S (1991) Touchdown PCR to
circumvent spurious priming during gene amplification Nucleic Acids Res 194008

SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 21 of 30


Appendix A Troubleshooting Guide
Optimizing your 5’ and 3’RACE reactions is generally advisable and often necessary This process usually consists of
improving the yield of your desired fragment(s) while decreasing the amount of background or nonspecific andor
incomplete bands in your RACE reactions The cDNA synthesis protocols contained in this User Manual typically
produce enough 5’ and 3’RACEReady cDNA for 100 or more RACE PCR reactions Thus there is plenty of material
for optimizing your RACE amplifications
A Troubleshooting Touchdown PCR
When troubleshooting touchdown PCR begin by modifying the final set of cycling parameters (ie the
20–25 cycles performed with annealing at 68°C) If you do not observe an amplified product after the
minimum number of cycles at 68°C return your tube(s) to the thermal cycler and run five additional
cycles If the product still does not appear add an additional 3–5 cycles at 68°C If you are still
unsuccessful run a new PCR experiment changing the annealing temperature in the third set of cycles
from 68°C to 65°C This last program is especially useful if your GSP has a Tm close to 70°C
If increasing the number of cycles does not solve your problem try diluting your template in a smaller
amount of TricineEDTA buffer (Section VD Step 12) thus raising the concentration of template in the
RACE reaction
Positive Control RACE PCR Experiment
Also consider running a positivecontrol reaction using RACEready cDNA generated from the included
Control Mouse Heart Total RNA during firststrand cDNA synthesis (Section VD) Carry this control
reaction through touchdown PCR using the provided Control 5’ or 3’RACE TFR Primers Perform the
positive control reaction as stated in Section VIB Steps 1–3 Replace your experimental sample cDNA
with 25 µl control 5’ or 3’cDNA and your GSPs with 1 µl each 5’ and 3’RACE TFR Primers
Analyze 5 µl on a 12 agaraoseEtBr gel

SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 22 of 30


Expected Results
The 3’RACE control reaction should produce a 31 kb band (Figure 4 Lane 1) The 5’RACE control
reaction should produce a 21 kb band (Figure 4 Lane 2) Before you attempt 5’ and 3’RACE with your
primers and experimental cDNA we recommend you optimize your positive control reactions so that they
produce distinct bands of the correct size

Control PCR Reactions
There are several control reactions that will help you troubleshoot your RACE reactions if yields are
suboptimal These include
 Control Reaction 1 An additional positive control using both GSPs to amplify the overlapping
segment of your 5’ and 3’RACE fragments (if available) This reaction should give a single band
corresponding to the overlap between the primers and confirms that your target cDNA is present in
and can be amplified from your RACEReady cDNA
 Control Reaction 2 A negative control using the UPM alone to amplify your cDNA With fewer
than 40 cycles this reaction should produce no product If this control produces a smear or ladder of
extra bands you may need to alter the cycling parameters or perform a secondary amplification using
the UPM Short and NGSP
 Control Reaction 3 (if working with mouse RNA) 5’ or 3’RACE PCR using the positive control
TFR Primer the UPM Primer Mix and the 5’ and 3’RACEReady cDNA made from your
experimental RNA Figure 4 (above) shows the expected results of 5’ and 3’RACE using these
positive controls
 Control Reaction 4 A negative control using each GSP by itself This control should produce no
product If this control produces a smear or ladder of extra bands you may need to alter the cycling
parameters perform a secondary amplification using nested primers or redesign your original
primers
If your control reactions provide appropriate bands but you still have trouble with your experimental
samples go back and check the quantity and quality of your RNA template (Section VC) Rare
transcripts may be especially difficult to amplify from your RNA sample
Figure 4 3' and 5'RACE sample results The gel shows
the 3’ and 5’RACE amplifications of transferrin receptor
starting with mouse heart total RNA Lane M 1 kb DNA
marker Lanes 1 & 2 transferring receptor (TFR) The 3’
product will be 31 kb the 5’ product will be 21 kb As
seen here minor products will occasionally be generated in
transferrin receptor 5’RACE

SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 23 of 30


B Multiple Band RACE Products
In some cases your initial experiments will produce multiple 5’ andor 3’RACE products You will
have to determine which products are real and which are artifacts While the following guidelines will
help you eliminate artifacts confirmation of real and complete bands requires additional studies such as
mapping of transcription start sites intronexon structure and polyadenylation sites and genomic
sequencing
Even if you produce multiple products in some cases you can and should proceed with generating
fulllength cDNA (see Section VII) If multiple fragments persist you should generally start with the
largest fragment from each RACE reaction because it is most likely to be a true complete RACE
product
1 Sources of Real Multiple RACE Products
Individual genes can give rise to multiple transcripts of different sizes—and hence to multiple
RACE fragments—via at least three mechanisms
 Alternative splicing can cause multiple products in 5’ or 3’RACE
 Different transcription initiation sites cause multiple 5’RACE products
 Different polyadenylation sites cause multiple 3’RACE products
Alternatively the gene may be a member of a multigene family in which case your gene
specific primers may simultaneously amplify several highly homologous cDNAs
Distinguishing true polymorphic forms of an RNA is a matter for scientific investigation
However you may be able to find an alternative source of RNA in which one form is more
abundant than others
2 Sources of Artifacts
Multiple bands often do not correspond to actual complete transcripts These artifact RACE
products can be divided into two classes—incomplete and nonspecific
 Incomplete fragments which are generated from correctly primed sites can be due to
degradation of the RNA template Generally degraded RNA used as starting material
causes multiple 5’RACE products
 Nonspecific RACE products arise from nonspecific binding of the primer to multiple
sites in the ds cDNA or primerdimer artifacts
3 Troubleshooting Suggestions for MultipleBand RACE Products
A secondary or nested PCR reaction using the UPM Short and an NGSP is discussed in
Section IVD and Section VIB Step 4 This secondary PCR will most likely result in the
expected distinct band(s) If this does not solve the problem of multiple RACE products proceed
with the suggestions below
 If you have not already done so repeat your RACE reactions with all of the recommended
controls In particular be sure that your GSPs do not give bands when used alone and that
they give a single band when used together If either GSP alone gives persistent bands we
recommend altering the cycling parameters or designing nested primers as discussed below
Also include the Positive Control RACE PCR Experiment (Appendix A Section A)

SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 24 of 30


 Repeat your reactions using 5 µl of a 5–10fold dilution of the RACEReady cDNA
 If you have not already done so examine the size distribution of your RNA starting material
as discussed in Section VC If your RNA looks smaller than expected repurify your RNA
and repeat cDNA synthesis
 If multiple bands persist try designing a new set of primers
1 Redesign your primers so that they have a Tm greater than 70°C (calculated based
upon the genespecific end of the primer only) and use the cycling parameters for
touchdown PCR Remember the Tm…
2 We recommend that you design new primers that will give RACE products that are
slightly different in size than those expected with the original primers These new
primers can either be used by themselves or in combination with the original primers
in nested PCR In nested PCR the product of a PCR reaction is reamplified using
a second set of primers that is internal to the original primers This often greatly
reduces the background and nonspecific amplification seen with either set of primers
alone The design of nested primers is discussed in Section IVD
3 Prior to performing nested RACE PCR we recommend that you perform two
separate primary amplifications with the UPM and either the GSP1 or NGSP1 This
test will help show if multiple bands are a result of correctly primed PCR or
nonspecifically primed PCR If the multiple bands are real (ie the result of correct
priming) they should be present in both reactions but slightly smaller in the reaction
using the nested primers The difference in the mobility of the products should
correspond to the positions of the GSP and NGSP in the cDNA structure
 If multiple bands persist try altering the PCR cycling parameters
1 Increase the stringency of your PCR by raising the annealing temperature in
increments of 2–5°C In many cases bands arising from nonspecific priming will
disappear while real or incomplete products will persist
2 Reduce the cycle number Again bands arising from nonspecific priming may
disappear while real or incomplete products will persist
3 Reduce the extension time
4 In the case of large RACE products increasing the extension time may help eliminate
extra bands
If none of these methods improve your RACE reactions it is most likely due to a problem with
RNA quality

SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 25 of 30


C Other Specific Problems
Table 3 Troubleshooting Guide Other Specific Problems
Problem Possible Explanation Solution
Using your
experimental cDNA
sample no 5’ or 3’
RACE bands are
produced but the
positive control RACE
reactions give the
expected products
Your gene may not be
abundant in your RNA sample
Perform 5 more PCR cycles at the 68°C
annealing temperature Repeat these
additional cycles until your RACE
fragments appear but do not exceed
50 cycles for touchdown PCR or 40
cycles for nontouchdown PCR If you
still fail to produce the expected
products you may have to find a new
source of RNA in which your gene is
more abundant
The annealing temperature is
too high for your primers
Lower the annealing temperature by
increments of 2°C
Your primers are not suitable
for PCR
Check your primers against the criteria
in Section IV and design new ones if
necessary
Extensive secondary structure
andor high GCcontent prevent
an efficient amplification of your
gene of interest
Try redesigning your primers closer to
the ends of the cDNA or try to avoid
GCrich regions if they are known
RACE cDNA product is
smeared

NOTE Some SMARTer
RACE reactions produce
very complex patterns of
bands that appear almost
as smears
In most cases of true smearing
a problem has occurred prior to
the RACE reaction especially if
the 3’RACE reaction produces
a smear
In these cases we recommend
repeating the entire procedure after
repurifying your RNA (or confirming
that your RNA is intact and clean) See
Section VB for more details
Smearing of only the
5’RACE reaction products may
indicate a difficult template for
reverse transcription or
degraded RNA
Smearing of both reactions is a
strong indication of
contamination of your starting
RNA or a problem in reverse
transcription
Your genespecific primer was
not specific
Redesign your genespecific primer
If smearing is apparently not due to a problem that occurred prior to
RACE try optimizing your RACE reactions using the troubleshooting
suggestions for multiple band RACE products in Section B of the
Troubleshooting Guide

SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 26 of 30


Problem Possible Explanation Solution
No band is observed
using GSP1 + GSP2
with your experimental
sample but a band is
seen with your positive
control
Your gene may be expressed
weakly or not at all in your
starting RNA
You may have to find a new source of
RNA The efficiency of both 5’ and
3’RACE amplifications depends on the
abundance of the target transcript
There is a problem with your
primers This could be due to
either poor primer design or
poor primer preparation
First try lowering your
annealingextension temperatures If
this does not work you may need to
design new primers or repurify your
GSPs
You may be able to obtain more information by amplifying the internal
fragment (with GSP1 and GSP2) using genomic DNA as the template If
the expected band is produced your primers are suitable and the problem
is either (a) the target RNA is a poor template for the RT or (b) the RNA is
not expressed in the tissue source you have chosen Note however that
this test is not conclusive since your primers may be separated by an
intron in the genomic DNA If this is the case amplification of genomic
DNA will give a larger fragment than expected or no fragment at all
No bands are observed
in any RACE reactions
using either gene
specific or positive
control primers with
either experimental or
control RNA samples
You may have to optimize your
PCR cycling parameters
If you still do not observe RACE
products after 25–30 cycles of PCR
(especially in both 5’ and 3’RACE
reactions) return the tubes to your
thermal cycler and perform 5 additional
cycles
The cDNA synthesis andor
template switching reaction has
failed
In this case try repeating the firststrand
cDNA synthesis reactions
No band is observed in
positive control
amplification of
overlapping region of
RACE products with
GSP1 + GSP2
Your cDNA synthesis reaction
may have failed
Repeat the firststrand cDNA synthesis
reaction

SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 27 of 30


Appendix B Detailed Flow Chart of 5’ RACE


Figure 5 Detailed mechanism of the 5'RACE reactions

SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 28 of 30


Appendix C Detailed Flow Chart of 3’ RACE


Figure 6 Detailed mechanism of the 3'RACE reactions

SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 29 of 30


Appendix D 5’RACE cDNA Amplification with Random Primers
If your RNA template is from a noneukaryotic organism andor lacks a polyadenylated tail use the following
protocol for firststrand cDNA synthesis with random priming
A Protocol FirstStrand cDNA Synthesis with Random Priming
1 Prepare enough of the following Buffer Mix for all of the 5’RACEReady cDNA synthesis reactions
plus 1 extra reaction to ensure sufficient volume For each 10 µl cDNA synthesis reaction mix the
following reagents and spin briefly in a microcentrifuge then set aside at room temperature until Step 6
40 µl 5X FirstStrand Buffer
05 µl DTT (100 mM)
10 µl dNTPs (20 mM)
55 µl Total Volume
2 Combine the following reagents in separate microcentrifuge tubes
For preparation of
5’RACEReady cDNA
10–10 µl RNA*
10 µl 10X Random Primer Mix
0–9 µl Sterile H2O
11 µl Total Volume
*For the control synthesis use 1 µl of Control Mouse Heart Total RNA (1 µgµl)
3 Mix contents and spin the tubes briefly in a microcentrifuge
4 Incubate tubes at 72°C for 3 minutes then cool the tubes to 42°C for 2 minutes After cooling spin
the tubes briefly for 10 seconds at 14000 x g to collect the contents at the bottom
NOTE This step can be performed in a thermal cycler While the tubes are incubating you can
prepare the Master Mix in Step 6
5 To the 5’RACE cDNA synthesis reaction(s) add 1 µl of the SMARTer II A Oligonucleotide per
reaction
6 Prepare enough of the following Master Mix for all 5’RACEReady cDNA synthesis reactions Mix
these reagents at room temperatures in the following order
55 µl Buffer Mix from Step 1
05 µl RNase Inhibitor (40 Uµl)
20 µl Reverse Transcriptase (100 U)
80 µl Total Volume
7 Add 8 µl of the Master Mix from Step 6 to the denatured RNA from Step 5 (5’RACE cDNA) for a
total volume of 20 µl
8 Mix the contents of the tubes by gently pipetting and spin the tubes briefly to collect the contents at
the bottom
SMARTer® RACE 5’3’ Kit User Manual
(012615) wwwclontechcom
Clontech Laboratories Inc A Takara Bio Company
Page 30 of 30


9 Incubate the tubes at 42°C for 90 minutes in an air incubator or a hotlid thermal cycler
NOTE Using a water bath for this incubation may reduce the volume of the reaction mixture (due to
evaporation) and therefore reduce the efficiency of firststrand cDNA synthesis
10 Heat tubes at 70°C for 10 minutes
11 Dilute the firststrand reaction product with TricineEDTA Buffer
 Add 10 µl if you started with <200 ng of total RNA*
 Add 90 µl if you started with >200 ng of total RNA*
*The copy number of your gene of interest should be the determining factor for diluting your sample
If you have 200 ng of total RNA but your gene of interest has low abundance dilute with 10 µl If
you have 200 ng of total RNA and the gene of interest is highly abundant dilute with 90 µl
12 Samples can be stored at –20°C for up to three months


Contact Us
Customer ServiceOrdering Technical Support
tel 8006622566 (tollfree) tel 8006622566 (tollfree)
fax 8004241350 (tollfree) fax 8004241350 (tollfree)
web wwwclontechcom web wwwclontechcom
email orders@clontechcom email tech@clontechcom

Notice to Purchaser
Clontech products are to be used for research purposes only They may not be used for any other purpose including but not limited to use in drugs in vitro diagnostic
purposes therapeutics or in humans Clontech products may not be transferred to third parties resold modified for resale or used to manufacture commercial products
or to provide a service to third parties without prior written approval of Clontech Laboratories Inc
Your use of this product is also subject to compliance with any applicable licensing requirements described on the product’s web page at httpwwwclontechcom It is
your responsibility to review understand and adhere to any restrictions imposed by such statements
SYBR is a registered trademark of Molecular Probes Inc
Clontech the Clontech logo InFusion SeqAmp SMART SMARTer SMARTScribe and Stellar are trademarks of Clontech Laboratories Inc All other marks are the
property of their respective owners Certain trademarks may not be registered in all jurisdictions Clontech is a Takara Bio Company ©2015 Clontech Laboratories
Inc
This document has been reviewed and approved by the Clontech Quality Assurance Department

《香当网》用户分享的内容，不代表《香当网》观点或立场，请自行判断内容的真实性和可靠性！
该内容是文档的文本内容，更好的格式请下载文档